| Browse |
| Prediction results retrieved after performance evaluation of WHO approved 34 primers to estimate their binding affinities for 3892 SARS-CoV-2 variants. |
| Lineage (WHO label)   | Target Gene | Primer Name | Primer Sequence | Primer Length | Primer GC Content (%) | Start Position | End Position | Primer Direction | ΔG (cal) | Primer first used |
|---|---|---|---|---|---|---|---|---|---|---|
| AY.28 (Delta) | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -2999.47 | Singapore |
| B.1.1.272 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.1.371 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| AA.1 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.1.353 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.407 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| AA.4 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.160.13 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.1.47 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.182 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.1.218 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| XBB.1.12.1 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| A.11 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| AY.22 (Delta) | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.128 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.254 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| AY.39.1.1 (Delta) | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -2999.47 | Singapore |
| B.1.418 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.9.1 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.40 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.1.122 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| XAJ | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.431 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.168 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| Q.6 (Alpha) | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| AZ.2 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| XBF.1.1 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.343 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -18611 | Singapore |
| AY.4.17 (Delta) | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -2999.47 | Singapore |
| AY.25.1.2 (Delta) | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -2999.47 | Singapore |
| B.1.1.409 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.1.83 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.1.310 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.362.1 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.1.162 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| Y.1 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.1.86 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| BA.2.38.1 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| XAV | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| BE.1.4.4 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| XBC.1.3 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| BM.4.1 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| BF.20 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| BA.2.77 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| CP.1.3 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| FC.1 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| BY.1.2 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| BF.7.17 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| AY.123 (Delta) | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| BQ.1.27 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| Lineage (WHO label) | Target Gene | Primer Name | Primer Sequence | Primer Length | Primer GC Content (%) | Start Position | End Position | Primer Direction | ΔG (cal) | Primer first used |