| Browse |
| Prediction results retrieved after performance evaluation of WHO approved 34 primers to estimate their binding affinities for 3892 SARS-CoV-2 variants. |
| Lineage (WHO label)   | Target Gene | Primer Name | Primer Sequence | Primer Length | Primer GC Content (%) | Start Position | End Position | Primer Direction | ΔG (cal) | Primer first used |
|---|---|---|---|---|---|---|---|---|---|---|
| BA.2.39 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| XW | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| BA.1.10 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| JN.8 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| KG.1 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| XDJ | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| HK.3.8 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| GK.1.7 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| JN.5.1 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| JN.1.36.1 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| BA.2.86.4 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| LV.1 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| HK.23 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| GE.1.2.1 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | 596.957 | Singapore |
| JN.2.2.1 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| JC.2 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| KE.2 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| FY.8.1 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| C.30 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.177.56 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| JD.1.1.4 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| XDT | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| HK.21 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| JN.2.3 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.617.3 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| AY.109 (Delta) | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| AY.4.2.2 (Delta) | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| AY.4.2.3 (Delta) | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| AY.4.8 (Delta) | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.617.1 (Kappa) | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| AY.4.3 (Delta) | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| AY.46.5 (Delta) | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| XDF | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.575.1 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| JN.12 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| GK.10 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| XBB.2.3.10 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.620 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| JN.2.4 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| XDM | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| BA.1.16 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | 596.957 | Singapore |
| BA.2.30 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| JN.3.1 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| BA.5.5.2 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| BA.2.37 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| BA.5.2.57 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| CN.1 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| BA.4.5 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| BA.2.54 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| BF.18 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| Lineage (WHO label) | Target Gene | Primer Name | Primer Sequence | Primer Length | Primer GC Content (%) | Start Position | End Position | Primer Direction | ΔG (cal) | Primer first used |