| Browse |
| Prediction results retrieved after performance evaluation of WHO approved 34 primers to estimate their binding affinities for 3892 SARS-CoV-2 variants. |
| Lineage (WHO label)   | Target Gene | Primer Name | Primer Sequence | Primer Length | Primer GC Content (%) | Start Position | End Position | Primer Direction | ΔG (cal) | Primer first used |
|---|---|---|---|---|---|---|---|---|---|---|
| BA.2.75.4 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| BA.5.1.26 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| BA.5.1.26 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| BN.6 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| BN.6 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| BF.19 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| BF.19 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| BA.5.2.51 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| BA.5.2.51 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| CA.6 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| CA.6 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| EQ.1 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| EQ.1 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| JU.1 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| JU.1 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| CJ.1 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| CJ.1 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| BM.1.1.1 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| BM.1.1.1 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| DE.1 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| DE.1 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| BA.5.1.8 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| BA.5.1.8 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| XBB.2.2 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| XBB.2.2 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| CH.3 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| CH.3 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| EF.3 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| EF.3 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| BR.4 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| BR.4 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| BN.1.2.5 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| BN.1.2.5 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| CP.4 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| CP.4 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| CA.3 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| CA.3 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| BN.5 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| BN.5 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| BE.8 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| BE.8 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| BF.7.1 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| BF.7.1 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| BH.1 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| BH.1 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| BL.1.3 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| BL.1.3 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| BS.1.2 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| BS.1.2 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| BF.7.13.1 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| Lineage (WHO label) | Target Gene | Primer Name | Primer Sequence | Primer Length | Primer GC Content (%) | Start Position | End Position | Primer Direction | ΔG (cal) | Primer first used |