| Browse |
| Prediction results retrieved after performance evaluation of WHO approved 34 primers to estimate their binding affinities for 3892 SARS-CoV-2 variants. |
| Lineage (WHO label)   | Target Gene | Primer Name | Primer Sequence | Primer Length | Primer GC Content (%) | Start Position | End Position | Primer Direction | ΔG (cal) | Primer first used |
|---|---|---|---|---|---|---|---|---|---|---|
| B.1.515 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| B.1.258.23 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| B.1.258.23 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| B.1.370 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| B.1.370 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| B.1.118 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| B.1.118 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| B.1.137 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| B.1.137 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -10257.2 | Singapore |
| B.1.309 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| B.1.309 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| B.1.1.157 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| B.1.1.157 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| B.1.1.176 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| B.1.1.176 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| AY.3.4 (Delta) | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| AY.3.4 (Delta) | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| B.1.1.391 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| B.1.1.391 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| B.1.393 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| B.1.393 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| B.1.432 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| B.1.432 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| XBC.1.6.1 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| FL.4.4 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| FL.4.4 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| FQ.1 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| FQ.1 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| JB.1.1 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| JB.1.1 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| XBB.1.17 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| XBB.1.17 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| FL.3.4 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| FL.3.4 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| FZ.1 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| FZ.1 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| DV.7.2 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| DV.7.2 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| FL.6 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| FL.6 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| FL.30.1 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| FL.30.1 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| XBB.1.5.68 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| XBB.1.5.68 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| CD.1 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| CD.1 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| EG.9 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| EG.9 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| XBU | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| XBU | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| Lineage (WHO label) | Target Gene | Primer Name | Primer Sequence | Primer Length | Primer GC Content (%) | Start Position | End Position | Primer Direction | ΔG (cal) | Primer first used |