| Browse |
| Prediction results retrieved after performance evaluation of WHO approved 34 primers to estimate their binding affinities for 3892 SARS-CoV-2 variants. |
| Lineage (WHO label)   | Target Gene | Primer Name | Primer Sequence | Primer Length | Primer GC Content (%) | Start Position | End Position | Primer Direction | ΔG (cal) | Primer first used |
|---|---|---|---|---|---|---|---|---|---|---|
| LN.1.1 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| JN.1.25.1 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| JN.1.25.1 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| JN.1.16.2 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| JN.1.16.2 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| JN.1.57.1 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| JN.1.57.1 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| JN.1.44.1 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| JN.1.44.1 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| XDP.3 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| XDP.3 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| KR.5 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| KR.5 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| KZ.1.1 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| KZ.1.1 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| KS.1.2 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| KS.1.2 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| BA.1.19 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| BA.1.19 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| HN.1 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| HN.1 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| JN.1.47 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| JN.1.47 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| JN.1.23 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| JN.1.23 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| KP.4.2.2 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| KP.4.2.2 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| LK.1 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| LK.1 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| XDS | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| XDS | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| LY.2 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| LY.2 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| JN.2.2 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| JN.2.2 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| XDD.3 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| XDD.3 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| KR.1.2 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| KR.1.2 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| MD.2 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| MD.2 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| XDD.1 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| XDD.1 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| JN.1.64.1 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| JN.1.64.1 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| HN.6 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| HN.6 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| DV.7.1.1 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| DV.7.1.1 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| HK.20.1 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| Lineage (WHO label) | Target Gene | Primer Name | Primer Sequence | Primer Length | Primer GC Content (%) | Start Position | End Position | Primer Direction | ΔG (cal) | Primer first used |