| Browse |
| Prediction results retrieved after performance evaluation of WHO approved 34 primers to estimate their binding affinities for 3892 SARS-CoV-2 variants. |
| Lineage (WHO label)   | Target Gene | Primer Name | Primer Sequence | Primer Length | Primer GC Content (%) | Start Position | End Position | Primer Direction | ΔG (cal) | Primer first used |
|---|---|---|---|---|---|---|---|---|---|---|
| P.1 (Gamma) | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| AY.120.1 (Delta) | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| AY.120.1 (Delta) | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| XBB.1.22 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| XBB.1.22 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| HK.3.13 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| HK.3.13 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| XCU | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| XCU | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| JN.6 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| JN.6 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| HK.27.1 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| HK.27.1 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| KB.2 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| KB.2 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| AY.2 (Delta) | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| AY.2 (Delta) | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| B.1.621 (Mu) | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| B.1.621 (Mu) | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| AY.9.2 (Delta) | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| AY.9.2 (Delta) | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| AY.34 (Delta) | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| AY.34 (Delta) | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| AY.47 (Delta) | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| AY.47 (Delta) | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| P.1.17 (Gamma) | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -17480.9 | Singapore |
| P.1.17 (Gamma) | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| AY.126 (Delta) | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| AY.126 (Delta) | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| XB | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| XB | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| AY.48 (Delta) | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| AY.48 (Delta) | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| AY.116.1 (Delta) | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| AY.116.1 (Delta) | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| AY.52 (Delta) | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| AY.52 (Delta) | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| JN.14 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| JN.14 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| HK.32 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| HK.32 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| JN.1.1.8 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| JN.1.1.8 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| JN.1.51.1 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| JN.1.51.1 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| XDD.1.1 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| XDD.1.1 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| B.1.526 (Iota) | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| B.1.526 (Iota) | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| FL.10 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| Lineage (WHO label) | Target Gene | Primer Name | Primer Sequence | Primer Length | Primer GC Content (%) | Start Position | End Position | Primer Direction | ΔG (cal) | Primer first used |