| Browse |
| Prediction results retrieved after performance evaluation of WHO approved 34 primers to estimate their binding affinities for 3892 SARS-CoV-2 variants. |
| Lineage (WHO label)   | Target Gene | Primer Name | Primer Sequence | Primer Length | Primer GC Content (%) | Start Position | End Position | Primer Direction | ΔG (cal) | Primer first used |
|---|---|---|---|---|---|---|---|---|---|---|
| BA.2.86.1 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| JN.1.34 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| JN.1.34 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| HK.3.2 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| HK.3.2 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| LA.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| LA.1 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| LF.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| LF.1 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| KP.4 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| KP.4 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| KP.2.16 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| KP.2.16 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| XBB.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| XBB.1 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| XDV.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| XDV.1 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| KP.5 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| KP.5 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| XDP.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| XDP.1 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| KP.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| KP.1 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| JN.1.31 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| JN.1.31 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| JN.1.11.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| JN.1.11.1 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| JD.1.1.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| JD.1.1.1 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| FP.4 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| FP.4 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| XBB.1.5.102 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| XBB.1.5.102 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| FK.1.3 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| FK.1.3 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| GN.5 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| GN.5 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| FL.31 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| FL.31 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| FL.13.3 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| FL.13.3 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| XBB.2.4 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| XBB.2.4 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| XBB.1.28.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| XBB.1.28.1 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| GA.6.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| GA.6.1 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| XBB.1.5.61 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| XBB.1.5.61 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| FR.1.2 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| Lineage (WHO label) | Target Gene | Primer Name | Primer Sequence | Primer Length | Primer GC Content (%) | Start Position | End Position | Primer Direction | ΔG (cal) | Primer first used |