| Browse |
| Prediction results retrieved after performance evaluation of WHO approved 34 primers to estimate their binding affinities for 3892 SARS-CoV-2 variants. |
| Lineage (WHO label)   | Target Gene | Primer Name | Primer Sequence | Primer Length | Primer GC Content (%) | Start Position | End Position | Primer Direction | ΔG (cal) | Primer first used |
|---|---|---|---|---|---|---|---|---|---|---|
| BA.2.30 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| BA.2.30 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| JN.3.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -12306.8 | Singapore |
| JN.3.1 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| XBB.1.13.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| XBB.1.13.1 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| GJ.6 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| GJ.6 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| XY | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| XY | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| CH.1.1.9 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| CH.1.1.9 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| EG.5.2.4 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| EG.5.2.4 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| BA.5.2.45 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -3872.72 | Singapore |
| BA.5.2.45 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| V.2 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| V.2 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.149 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.149 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.1.413 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.1.413 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.258.4 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -3872.72 | Singapore |
| B.1.258.4 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -2999.47 | Singapore |
| B.1.9.5 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.9.5 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.1.107 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.1.107 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.76 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.76 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.1.301 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.1.301 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.36.7 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.36.7 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.1.269 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.1.269 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.1.234 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.1.234 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| Z.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| Z.1 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.10 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.10 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.177.9 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.177.9 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| AY.4.10 (Delta) | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -3872.72 | Singapore |
| AY.4.10 (Delta) | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -2999.47 | Singapore |
| B.47 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.47 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.36.16 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.36.16 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| Lineage (WHO label) | Target Gene | Primer Name | Primer Sequence | Primer Length | Primer GC Content (%) | Start Position | End Position | Primer Direction | ΔG (cal) | Primer first used |