| Browse |
| Prediction results retrieved after performance evaluation of WHO approved 34 primers to estimate their binding affinities for 3892 SARS-CoV-2 variants. |
| Lineage (WHO label)   | Target Gene | Primer Name | Primer Sequence | Primer Length | Primer GC Content (%) | Start Position | End Position | Primer Direction | ΔG (cal) | Primer first used |
|---|---|---|---|---|---|---|---|---|---|---|
| B.1.177.10 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.177.10 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.177.19 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.177.19 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.1.311 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.1.311 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.93 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.93 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.104 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.104 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.469 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.469 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| BA.2.62 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| BA.2.62 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| AY.80 (Delta) | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| AY.80 (Delta) | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| AY.43.8 (Delta) | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -3872.72 | Singapore |
| AY.43.8 (Delta) | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -2999.47 | Singapore |
| AY.128 (Delta) | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| AY.128 (Delta) | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| A.21 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| A.21 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| AZ.3 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| AZ.3 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.1.270 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.1.270 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.1.227 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.1.227 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| U.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| U.1 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.36.28 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.36.28 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.177.15 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| AZ.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| AZ.1 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.436 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.436 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.558 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.558 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.1.518 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.1.518 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.1.368 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.1.368 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.404 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.404 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.177.15 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.177.24 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.177.24 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.1.236 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -15180.6 | Singapore |
| B.1.1.236 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| Lineage (WHO label) | Target Gene | Primer Name | Primer Sequence | Primer Length | Primer GC Content (%) | Start Position | End Position | Primer Direction | ΔG (cal) | Primer first used |