| Browse |
| Prediction results retrieved after performance evaluation of WHO approved 34 primers to estimate their binding affinities for 3892 SARS-CoV-2 variants. |
| Lineage (WHO label)   | Target Gene | Primer Name | Primer Sequence | Primer Length | Primer GC Content (%) | Start Position | End Position | Primer Direction | ΔG (cal) | Primer first used |
|---|---|---|---|---|---|---|---|---|---|---|
| HK.23 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| GE.1.2.1 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| GE.1.2.1 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| JN.2.2.1 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| JN.2.2.1 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| JC.2 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| JC.2 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| HK.21 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| HK.21 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| JN.2.3 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| JN.2.3 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| B.1.617.3 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| B.1.617.3 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| AY.109 (Delta) | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| AY.109 (Delta) | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| AY.4.2.2 (Delta) | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| AY.4.2.2 (Delta) | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| AY.4.2.3 (Delta) | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| AY.4.2.3 (Delta) | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| B.1.469 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| B.1.469 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| BA.2.62 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| BA.2.62 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| AY.80 (Delta) | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| AY.80 (Delta) | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| AY.43.8 (Delta) | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| AY.43.8 (Delta) | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| AY.128 (Delta) | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| AY.128 (Delta) | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| A.21 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| A.21 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| B.1.398 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| B.1.398 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| AY.94 (Delta) | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -17480.9 | Singapore |
| AY.94 (Delta) | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| HK.18 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| HK.18 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| B.1.177.18 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| B.1.177.18 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| B.1.177.17 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| B.1.177.17 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| B.1.1.164 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| B.1.1.164 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| B.1.1.275 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| B.1.1.275 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| B.1.258.2 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| B.1.258.2 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| B.1.177.58 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| B.1.177.58 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| B.1.177.81 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| Lineage (WHO label) | Target Gene | Primer Name | Primer Sequence | Primer Length | Primer GC Content (%) | Start Position | End Position | Primer Direction | ΔG (cal) | Primer first used |