| Browse |
| Prediction results retrieved after performance evaluation of WHO approved 34 primers to estimate their binding affinities for 3892 SARS-CoV-2 variants. |
| Lineage (WHO label)   | Target Gene | Primer Name | Primer Sequence | Primer Length | Primer GC Content (%) | Start Position | End Position | Primer Direction | ΔG (cal) | Primer first used |
|---|---|---|---|---|---|---|---|---|---|---|
| JN.1.18.2 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| LU.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| JN.1.40 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| MG.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| JN.1.59 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| LG.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| KP.2.10 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| LK.2.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| LB.1.7.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| KP.2.9 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| AY.25 (Delta) | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| AY.25.1 (Delta) | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| AY.25.3 (Delta) | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| AY.75 (Delta) | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| AY.100 (Delta) | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| AY.44 (Delta) | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -15597.1 | Singapore |
| KP.2.7 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| LD.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| KP.1.2 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| KW.1.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| KR.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| JN.1.15.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| JN.1.50.2 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| LB.1.5 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -3872.72 | Singapore |
| LF.3.1.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| JN.1.18.6 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -3872.72 | Singapore |
| XDK.3 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| KP.4.1.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| JN.1.26 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| JN.1.37 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| JQ.2.1.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -3872.72 | Singapore |
| JN.1.23.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| DY.3 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| KP.2.4 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| LJ.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| LE.1.2 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| EG.5.1.16 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| LE.1.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| XDQ | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| B.1.502 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.1.285 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.582 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.580 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.306 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.280 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.1.329 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.396 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.595.3 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.2 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| Lineage (WHO label) | Target Gene | Primer Name | Primer Sequence | Primer Length | Primer GC Content (%) | Start Position | End Position | Primer Direction | ΔG (cal) | Primer first used |