| Browse |
| Prediction results retrieved after performance evaluation of WHO approved 34 primers to estimate their binding affinities for 3892 SARS-CoV-2 variants. |
| Lineage (WHO label)   | Target Gene | Primer Name | Primer Sequence | Primer Length | Primer GC Content (%) | Start Position | End Position | Primer Direction | ΔG (cal) | Primer first used |
|---|---|---|---|---|---|---|---|---|---|---|
| BA.5.6.2 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| BA.5.1.10 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| BF.41 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| BA.5.1.2 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| BF.36 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| BF.12 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| BF.5.4 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| BQ.1.18 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| BF.5.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| B.1.258.9 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| BA.5.1.3 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| BA.5.1.23 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| BF.8 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| BA.5.2.28 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| BA.5.2.62 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| BA.5.2.24 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| BA.5.8 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| BF.28 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| BA.5.1.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| BE.1.1.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| XAZ | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| BE.4 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| BA.5.1.24 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| BA.5.1.16 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| BA.5.2.26 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| BA.5.2.2 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| BF.21 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| BA.5.6 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| BF.11.5 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| BQ.1.1.30 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| BQ.1.9 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| B.1.258.17 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| BA.5.1.37 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| EE.3 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| ES.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| B.1.625 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| BA.2.86.7 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| FL.39 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| BQ.1.2.2 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| BF.1.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| BA.4.6.2 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| DQ.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| BF.31.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| BQ.1.1.77 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| B.1.258.20 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| B.1.415.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| B.1.258.23 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| BP.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| DD.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| DJ.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| Lineage (WHO label) | Target Gene | Primer Name | Primer Sequence | Primer Length | Primer GC Content (%) | Start Position | End Position | Primer Direction | ΔG (cal) | Primer first used |