| Browse |
| Prediction results retrieved after performance evaluation of WHO approved 34 primers to estimate their binding affinities for 3892 SARS-CoV-2 variants. |
| Lineage (WHO label)   | Target Gene | Primer Name | Primer Sequence | Primer Length | Primer GC Content (%) | Start Position | End Position | Primer Direction | ΔG (cal) | Primer first used |
|---|---|---|---|---|---|---|---|---|---|---|
| DZ.2 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| BF.7.14.3 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| DY.4 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| XBB.1.12 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| BF.7.14.6 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| HK.3.13 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| XCU | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| JN.6 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| HK.27.1 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| KB.2 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| JN.14 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| HK.32 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| JN.1.1.8 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| JN.1.51.1 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| XDD.1.1 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.526 (Iota) | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| AY.2 (Delta) | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| B.1.621 (Mu) | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| AY.9.2 (Delta) | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| AY.34 (Delta) | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| AY.47 (Delta) | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| P.1.17 (Gamma) | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| AY.126 (Delta) | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| XB | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| AY.48 (Delta) | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| AY.116.1 (Delta) | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| AY.52 (Delta) | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| AY.13 (Delta) | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| AY.35 (Delta) | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| P.1 (Gamma) | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| AY.120.1 (Delta) | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| AY.119.2 (Delta) | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| XBB.1.22 | S | Chan-S | CAAGCTATAACGCAGCCTGTA | 21 | 47.62 | 22869 | 22849 | R | -22073.5 | China |
| HK.3.13 | S | Chan-S | CAAGCTATAACGCAGCCTGTA | 21 | 47.62 | 22869 | 22849 | R | -22073.5 | China |
| XCU | S | Chan-S | CAAGCTATAACGCAGCCTGTA | 21 | 47.62 | 22869 | 22849 | R | -22073.5 | China |
| JN.6 | S | Chan-S | CAAGCTATAACGCAGCCTGTA | 21 | 47.62 | 22869 | 22849 | R | -22073.5 | China |
| HK.27.1 | S | Chan-S | CAAGCTATAACGCAGCCTGTA | 21 | 47.62 | 22869 | 22849 | R | -22073.5 | China |
| KB.2 | S | Chan-S | CAAGCTATAACGCAGCCTGTA | 21 | 47.62 | 22869 | 22849 | R | -22073.5 | China |
| JN.14 | S | Chan-S | CAAGCTATAACGCAGCCTGTA | 21 | 47.62 | 22869 | 22849 | R | -22073.5 | China |
| HK.32 | S | Chan-S | CAAGCTATAACGCAGCCTGTA | 21 | 47.62 | 22869 | 22849 | R | -22073.5 | China |
| JN.1.1.8 | S | Chan-S | CAAGCTATAACGCAGCCTGTA | 21 | 47.62 | 22869 | 22849 | R | -22073.5 | China |
| JN.1.51.1 | S | Chan-S | CAAGCTATAACGCAGCCTGTA | 21 | 47.62 | 22869 | 22849 | R | -22073.5 | China |
| XDD.1.1 | S | Chan-S | CAAGCTATAACGCAGCCTGTA | 21 | 47.62 | 22869 | 22849 | R | -22073.5 | China |
| B.1.526 (Iota) | S | Chan-S | CAAGCTATAACGCAGCCTGTA | 21 | 47.62 | 22869 | 22849 | R | -22073.5 | China |
| AY.2 (Delta) | S | Chan-S | CAAGCTATAACGCAGCCTGTA | 21 | 47.62 | 22869 | 22849 | R | -22073.5 | China |
| B.1.621 (Mu) | S | Chan-S | CAAGCTATAACGCAGCCTGTA | 21 | 47.62 | 22869 | 22849 | R | -22073.5 | China |
| AY.9.2 (Delta) | S | Chan-S | CAAGCTATAACGCAGCCTGTA | 21 | 47.62 | 22869 | 22849 | R | -22073.5 | China |
| AY.34 (Delta) | S | Chan-S | CAAGCTATAACGCAGCCTGTA | 21 | 47.62 | 22869 | 22849 | R | -22073.5 | China |
| AY.47 (Delta) | S | Chan-S | CAAGCTATAACGCAGCCTGTA | 21 | 47.62 | 22869 | 22849 | R | -22073.5 | China |
| P.1.17 (Gamma) | S | Chan-S | CAAGCTATAACGCAGCCTGTA | 21 | 47.62 | 22869 | 22849 | R | -22073.5 | China |
| Lineage (WHO label) | Target Gene | Primer Name | Primer Sequence | Primer Length | Primer GC Content (%) | Start Position | End Position | Primer Direction | ΔG (cal) | Primer first used |