| Browse |
| Prediction results retrieved after performance evaluation of WHO approved 34 primers to estimate their binding affinities for 3892 SARS-CoV-2 variants. |
| Lineage (WHO label)   | Target Gene | Primer Name | Primer Sequence | Primer Length | Primer GC Content (%) | Start Position | End Position | Primer Direction | ΔG (cal) | Primer first used |
|---|---|---|---|---|---|---|---|---|---|---|
| JN.1.50.2 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| BA.1.15 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| BA.1.14.2 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| BA.1.14.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| BA.1 (Omicron) | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| BA.1.17.2 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| JN.1.6 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| ME.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| BA.1.1.11 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| BA.1.21.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| BA.1.17.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| BA.1.13.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| BA.1.1.7 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| XF | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| XS | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| B.1.258.22 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| BC.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| BA.1.22 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| BA.1.2 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| BA.1.1 (Omicron) | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| JN.1.50 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| BA.1.13 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| BA.1.6 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| BA.1.1.17 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| BA.1.10 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| BA.1.8 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| BA.1.12 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| BA.1.7 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| BA.1.1.12 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| BA.1.1.13 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| BA.1.1.15 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| BA.1.1.4 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| BD.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| BA.1.5 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| BA.1.14 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| B.1.525 (Eta) | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| BA.1.16.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| BA.1.4 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| BA.1.23 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| BA.1.3 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| BC.2 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| BA.1.1.9 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| BA.1.1.3 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| BA.3 (Omicron) | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| BA.3.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| BA.1.16.2 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13443.5 | Singapore |
| BA.2 (Omicron) | S | Chan-S | CAAGCTATAACGCAGCCTGTA | 21 | 47.62 | 22869 | 22849 | R | -13440.2 | China |
| B.1.258.17 | ORF1ab | NIID WH-1 F509R854 | CTCGAACTGCACCTCATGG | 19 | 57.89 | 492 | 510 | F | -13419.5 | Japan |
| AY.33 (Delta) | ORF1ab | Pasteur-ORF1ab-2 | GGTAACTGGTATGATTTCG | 19 | 42.11 | 14080 | 14098 | F | -13363.1 | France |
| FR.1 | ORF1ab | Pasteur-ORF1ab-2 | GGTAACTGGTATGATTTCG | 19 | 42.11 | 14080 | 14098 | F | -13363.1 | France |
| Lineage (WHO label) | Target Gene | Primer Name | Primer Sequence | Primer Length | Primer GC Content (%) | Start Position | End Position | Primer Direction | ΔG (cal) | Primer first used |