| Browse |
| Prediction results retrieved after performance evaluation of WHO approved 34 primers to estimate their binding affinities for 3892 SARS-CoV-2 variants. |
| Lineage (WHO label)   | Target Gene | Primer Name | Primer Sequence | Primer Length | Primer GC Content (%) | Start Position | End Position | Primer Direction | ΔG (cal) | Primer first used |
|---|---|---|---|---|---|---|---|---|---|---|
| B.1.595.3 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.2 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.311 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.369 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.367 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.595 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.240 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| JD.1.1.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| HK.3.2 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| JG.3.2 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| HV.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| B.1.1.529 (Omicron) | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| BA.2.3.20 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| AY.33 (Delta) | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| AY.99.2 (Delta) | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| KB.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| XBB.1.5.81 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| CH.1.1.20 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| XBL.3.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| XBB.2.4 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| XBB.1.28.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| GA.6.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| XBB.1.5.61 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| FR.1.2 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| FL.2.2.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| FL.25 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| FL.33 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| FL.29 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| EG.13 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| GP.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| HL.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| XCD | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| XBB.1.44.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| EG.2.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| FL.37 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| XBB.1.45.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| FP.4 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| XBB.1.5.102 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| FK.1.3 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| GN.5 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| FL.31 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| FL.13.3 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| EG.7 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| BN.1.3.5 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| XCF.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| XCC | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| FK.1.5 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| FL.21.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| FP.2.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| XBB.1.5.92 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| Lineage (WHO label) | Target Gene | Primer Name | Primer Sequence | Primer Length | Primer GC Content (%) | Start Position | End Position | Primer Direction | ΔG (cal) | Primer first used |