Browse

Prediction results retrieved after performance evaluation of WHO approved 34 primers to estimate their binding affinities for 3892 SARS-CoV-2 variants.

Lineage (WHO label)	Target Gene	Primer Name	Primer Sequence	Primer Length	Primer GC Content (%)	Start Position	End Position	Primer Direction	ΔG (cal)	Primer first used
Q.3 (Alpha)	N	Young-N	CTCAGTCCAAGATGGTATTTCT	22	40.91	28583	28604	F	-21953.9	Singapore
Q.3 (Alpha)	N	Young-N	AGCACCATAGGGAAGTCC	18	55.56	28648	28631	R	-19874.5	Singapore
B.1.1.523	ORF1ab	Young-ORF1ab	TCATTGTTAATGCCTATATTAACC	24	29.17	14155	14178	F	-20695.4	Singapore
B.1.1.523	ORF1ab	Young-ORF1ab	CACTTAATGTAAGGCTTTGTTAAG	24	33.33	14243	14220	R	-22408	Singapore
B.1.1.523	S	Young-S	TATACATGTCTCTGGGACCA	20	45	21763	21782	F	-19121.1	Singapore
B.1.1.523	S	Young-S	ATCCAGCCTCTTATTATGTTAGAC	24	37.5	21876	21853	R	-22070.7	Singapore
B.1.1.523	N	Young-N	CTCAGTCCAAGATGGTATTTCT	22	40.91	28583	28604	F	-21953.9	Singapore
B.1.1.523	N	Young-N	AGCACCATAGGGAAGTCC	18	55.56	28648	28631	R	-19874.5	Singapore
AY.116 (Delta)	ORF1ab	Young-ORF1ab	TCATTGTTAATGCCTATATTAACC	24	29.17	14155	14178	F	-20695.4	Singapore
AY.116 (Delta)	ORF1ab	Young-ORF1ab	CACTTAATGTAAGGCTTTGTTAAG	24	33.33	14243	14220	R	-22408	Singapore
BA.5.1.7	S	Young-S	TATACATGTCTCTGGGACCA	20	45	21763	21782	F	-13305.5	Singapore
BA.5.1.7	S	Young-S	ATCCAGCCTCTTATTATGTTAGAC	24	37.5	21876	21853	R	-22070.7	Singapore
BA.5.1.7	N	Young-N	CTCAGTCCAAGATGGTATTTCT	22	40.91	28583	28604	F	-21953.9	Singapore
BA.5.1.7	N	Young-N	AGCACCATAGGGAAGTCC	18	55.56	28648	28631	R	-19874.5	Singapore
DE.2	ORF1ab	Young-ORF1ab	TCATTGTTAATGCCTATATTAACC	24	29.17	14155	14178	F	-20695.4	Singapore
DE.2	ORF1ab	Young-ORF1ab	CACTTAATGTAAGGCTTTGTTAAG	24	33.33	14243	14220	R	-22408	Singapore
DE.2	S	Young-S	TATACATGTCTCTGGGACCA	20	45	21763	21782	F	-13305.5	Singapore
DE.2	S	Young-S	ATCCAGCCTCTTATTATGTTAGAC	24	37.5	21876	21853	R	-22070.7	Singapore
DE.2	N	Young-N	CTCAGTCCAAGATGGTATTTCT	22	40.91	28583	28604	F	-21953.9	Singapore
DE.2	N	Young-N	AGCACCATAGGGAAGTCC	18	55.56	28648	28631	R	-19874.5	Singapore
BQ.2	ORF1ab	Young-ORF1ab	TCATTGTTAATGCCTATATTAACC	24	29.17	14155	14178	F	-20695.4	Singapore
BQ.2	ORF1ab	Young-ORF1ab	CACTTAATGTAAGGCTTTGTTAAG	24	33.33	14243	14220	R	-22408	Singapore
BQ.2	S	Young-S	TATACATGTCTCTGGGACCA	20	45	21763	21782	F	-13305.5	Singapore
BQ.2	S	Young-S	ATCCAGCCTCTTATTATGTTAGAC	24	37.5	21876	21853	R	-22070.7	Singapore
BQ.2	N	Young-N	CTCAGTCCAAGATGGTATTTCT	22	40.91	28583	28604	F	-21953.9	Singapore
BQ.2	N	Young-N	AGCACCATAGGGAAGTCC	18	55.56	28648	28631	R	-19874.5	Singapore
B.1.333	ORF1ab	Young-ORF1ab	TCATTGTTAATGCCTATATTAACC	24	29.17	14155	14178	F	-20695.4	Singapore
B.1.333	ORF1ab	Young-ORF1ab	CACTTAATGTAAGGCTTTGTTAAG	24	33.33	14243	14220	R	-22408	Singapore
B.1.333	S	Young-S	TATACATGTCTCTGGGACCA	20	45	21763	21782	F	-19121.1	Singapore
B.1.333	S	Young-S	ATCCAGCCTCTTATTATGTTAGAC	24	37.5	21876	21853	R	-22070.7	Singapore
B.1.333	N	Young-N	CTCAGTCCAAGATGGTATTTCT	22	40.91	28583	28604	F	-21953.9	Singapore
B.1.333	N	Young-N	AGCACCATAGGGAAGTCC	18	55.56	28648	28631	R	-19874.5	Singapore
CM.6.1	ORF1ab	Young-ORF1ab	TCATTGTTAATGCCTATATTAACC	24	29.17	14155	14178	F	-20695.4	Singapore
CM.6.1	ORF1ab	Young-ORF1ab	CACTTAATGTAAGGCTTTGTTAAG	24	33.33	14243	14220	R	-22408	Singapore
CM.6.1	S	Young-S	TATACATGTCTCTGGGACCA	20	45	21763	21782	F	-19121.1	Singapore
CM.6.1	S	Young-S	ATCCAGCCTCTTATTATGTTAGAC	24	37.5	21876	21853	R	-22070.7	Singapore
CM.6.1	N	Young-N	CTCAGTCCAAGATGGTATTTCT	22	40.91	28583	28604	F	-21953.9	Singapore
CM.6.1	N	Young-N	AGCACCATAGGGAAGTCC	18	55.56	28648	28631	R	-19874.5	Singapore
BA.5.2.54	ORF1ab	Young-ORF1ab	TCATTGTTAATGCCTATATTAACC	24	29.17	14155	14178	F	-20695.4	Singapore
BA.5.2.54	ORF1ab	Young-ORF1ab	CACTTAATGTAAGGCTTTGTTAAG	24	33.33	14243	14220	R	-22408	Singapore
BA.5.2.54	S	Young-S	TATACATGTCTCTGGGACCA	20	45	21763	21782	F	-3680.15	Singapore
BA.5.2.54	S	Young-S	ATCCAGCCTCTTATTATGTTAGAC	24	37.5	21876	21853	R	-22070.7	Singapore
BA.5.2.54	N	Young-N	CTCAGTCCAAGATGGTATTTCT	22	40.91	28583	28604	F	-21953.9	Singapore
BA.5.2.54	N	Young-N	AGCACCATAGGGAAGTCC	18	55.56	28648	28631	R	-19874.5	Singapore
DR.2	ORF1ab	Young-ORF1ab	TCATTGTTAATGCCTATATTAACC	24	29.17	14155	14178	F	-20695.4	Singapore
DR.2	ORF1ab	Young-ORF1ab	CACTTAATGTAAGGCTTTGTTAAG	24	33.33	14243	14220	R	-22408	Singapore
DR.2	S	Young-S	TATACATGTCTCTGGGACCA	20	45	21763	21782	F	-13305.5	Singapore
DR.2	S	Young-S	ATCCAGCCTCTTATTATGTTAGAC	24	37.5	21876	21853	R	-22070.7	Singapore
DR.2	N	Young-N	CTCAGTCCAAGATGGTATTTCT	22	40.91	28583	28604	F	-21953.9	Singapore
DR.2	N	Young-N	AGCACCATAGGGAAGTCC	18	55.56	28648	28631	R	-19874.5	Singapore
Lineage (WHO label)	Target Gene	Primer Name	Primer Sequence	Primer Length	Primer GC Content (%)	Start Position	End Position	Primer Direction	ΔG (cal)	Primer first used