| Browse |
| Prediction results retrieved after performance evaluation of WHO approved 34 primers to estimate their binding affinities for 3892 SARS-CoV-2 variants. |
| Lineage (WHO label)   | Target Gene | Primer Name | Primer Sequence | Primer Length | Primer GC Content (%) | Start Position | End Position | Primer Direction | ΔG (cal) | Primer first used |
|---|---|---|---|---|---|---|---|---|---|---|
| AY.35 (Delta) | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| AY.35 (Delta) | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| AY.35 (Delta) | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| AY.122 (Delta) | ORF1ab | Young-ORF1ab | TCATTGTTAATGCCTATATTAACC | 24 | 29.17 | 14155 | 14178 | F | -20695.4 | Singapore |
| AY.122 (Delta) | ORF1ab | Young-ORF1ab | CACTTAATGTAAGGCTTTGTTAAG | 24 | 33.33 | 14243 | 14220 | R | -22408 | Singapore |
| AY.122 (Delta) | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -3872.72 | Singapore |
| AY.122 (Delta) | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -2999.47 | Singapore |
| AY.122 (Delta) | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| AY.122 (Delta) | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| B.1.1.7 (Alpha) | ORF1ab | Young-ORF1ab | TCATTGTTAATGCCTATATTAACC | 24 | 29.17 | 14155 | 14178 | F | -20695.4 | Singapore |
| B.1.1.7 (Alpha) | ORF1ab | Young-ORF1ab | CACTTAATGTAAGGCTTTGTTAAG | 24 | 33.33 | 14243 | 14220 | R | -22408 | Singapore |
| B.1.1.7 (Alpha) | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| B.1.1.7 (Alpha) | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -18863.5 | Singapore |
| XCU | ORF1ab | Young-ORF1ab | TCATTGTTAATGCCTATATTAACC | 24 | 29.17 | 14155 | 14178 | F | -20695.4 | Singapore |
| XCU | ORF1ab | Young-ORF1ab | CACTTAATGTAAGGCTTTGTTAAG | 24 | 33.33 | 14243 | 14220 | R | -22408 | Singapore |
| XCU | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| XCU | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| XCU | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| XCU | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| JN.6 | ORF1ab | Young-ORF1ab | TCATTGTTAATGCCTATATTAACC | 24 | 29.17 | 14155 | 14178 | F | -20695.4 | Singapore |
| JN.6 | ORF1ab | Young-ORF1ab | CACTTAATGTAAGGCTTTGTTAAG | 24 | 33.33 | 14243 | 14220 | R | -22408 | Singapore |
| JN.6 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| JN.6 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| JN.6 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| JN.6 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| HK.27.1 | ORF1ab | Young-ORF1ab | TCATTGTTAATGCCTATATTAACC | 24 | 29.17 | 14155 | 14178 | F | -20695.4 | Singapore |
| HK.27.1 | ORF1ab | Young-ORF1ab | CACTTAATGTAAGGCTTTGTTAAG | 24 | 33.33 | 14243 | 14220 | R | -22408 | Singapore |
| HK.27.1 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -15915.9 | Singapore |
| HK.27.1 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| HK.27.1 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| HK.27.1 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| KB.2 | ORF1ab | Young-ORF1ab | TCATTGTTAATGCCTATATTAACC | 24 | 29.17 | 14155 | 14178 | F | -20695.4 | Singapore |
| KB.2 | ORF1ab | Young-ORF1ab | CACTTAATGTAAGGCTTTGTTAAG | 24 | 33.33 | 14243 | 14220 | R | -22408 | Singapore |
| KB.2 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| KB.2 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| KB.2 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| KB.2 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| JN.14 | ORF1ab | Young-ORF1ab | TCATTGTTAATGCCTATATTAACC | 24 | 29.17 | 14155 | 14178 | F | -20695.4 | Singapore |
| JN.14 | ORF1ab | Young-ORF1ab | CACTTAATGTAAGGCTTTGTTAAG | 24 | 33.33 | 14243 | 14220 | R | -22408 | Singapore |
| JN.14 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -13305.5 | Singapore |
| JN.14 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| JN.14 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| JN.14 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| HK.32 | ORF1ab | Young-ORF1ab | TCATTGTTAATGCCTATATTAACC | 24 | 29.17 | 14155 | 14178 | F | -20695.4 | Singapore |
| HK.32 | ORF1ab | Young-ORF1ab | CACTTAATGTAAGGCTTTGTTAAG | 24 | 33.33 | 14243 | 14220 | R | -22408 | Singapore |
| HK.32 | S | Young-S | TATACATGTCTCTGGGACCA | 20 | 45 | 21763 | 21782 | F | -19121.1 | Singapore |
| HK.32 | S | Young-S | ATCCAGCCTCTTATTATGTTAGAC | 24 | 37.5 | 21876 | 21853 | R | -22070.7 | Singapore |
| HK.32 | N | Young-N | CTCAGTCCAAGATGGTATTTCT | 22 | 40.91 | 28583 | 28604 | F | -21953.9 | Singapore |
| HK.32 | N | Young-N | AGCACCATAGGGAAGTCC | 18 | 55.56 | 28648 | 28631 | R | -19874.5 | Singapore |
| JN.1.1.8 | ORF1ab | Young-ORF1ab | TCATTGTTAATGCCTATATTAACC | 24 | 29.17 | 14155 | 14178 | F | -20695.4 | Singapore |
| Lineage (WHO label) | Target Gene | Primer Name | Primer Sequence | Primer Length | Primer GC Content (%) | Start Position | End Position | Primer Direction | ΔG (cal) | Primer first used |